Unity in Diversity and the Standardisation of Clinical Pharmacy Services
eBook - ePub

Unity in Diversity and the Standardisation of Clinical Pharmacy Services

Proceedings of the 17th Asian Conference on Clinical Pharmacy (ACCP 2017), July 28-30, 2017, Yogyakarta, Indonesia

  1. 382 pages
  2. English
  3. ePUB (mobile friendly)
  4. Available on iOS & Android
eBook - ePub

Unity in Diversity and the Standardisation of Clinical Pharmacy Services

Proceedings of the 17th Asian Conference on Clinical Pharmacy (ACCP 2017), July 28-30, 2017, Yogyakarta, Indonesia

About this book

Unity in Diversity and the Standardisation of Clinical Pharmacy Services represents the proceedings of the 17th Asian Conference on Clinical Pharmacy (ACCP 2017), held 28—30 July 2017 in Yogyakarta, Indonesia. The primary aim of ACCP 2017 was to bring together experts from all fields of clinical pharmacy to facilitate the discussion and exchange of research ideas and results. The conference provided a forum for the dissemination of knowledge and exchange of experiences. As such, it brought together clinical pharmacy scholars, pharmacy practitioners, policy makers and stakeholders from all areas of pharmacy society and all regions of the world to share their research, knowledge, experiences, concepts, examples of good practice, and critical analysis with their international peers. This year also marks the celebration of 20 years of ACCP.

Central themes of the conference and contributed papers were Clinical Pharmacy, Social and Administrative Pharmacy, Pharmacy Education, Pharmacoeconomics, Pharmacoepidemiology, Complementary and Alternative Medicine (CAM) and a number of related topics in the field of Pharmacy.

Trusted byĀ 375,005 students

Access to over 1.5 million titles for a fair monthly price.

Study more efficiently using our study tools.

Information

Publisher
CRC Press
Year
2017
Print ISBN
9781138081727
eBook ISBN
9781351622974
Multidrug resistance-1 gene variants in pediatric leukemia in Bali
R. Niruri, N.L. Ulandari & S.C. Yowani
Department of Pharmacy, Faculty of Mathematics and Science, Udayana University, Bali, Indonesia
I. Narayani
Department of Biology, Faculty of Mathematics and Science, Udayana University, Bali, Indonesia
K. Ariawati
Division of Hematology Oncology, Department of Pediatrics, Sanglah Hospital, Bali, Indonesia
ABSTRACT: Variants of the Multidrug Resistance-1 (MDR1) gene play an important role in chemo-resistance in Acute Lymphoblastic Leukemia (ALL). In this study, we aimed to identify MDR1 gene variants 3435 and 2677 in children with ALL in Sanglah Hospital, Bali, and to determine their chemo-therapeutic outcome. All children with ALL admitted in Sanglah Hospital during May 2015 to January 2016 were included. The PCR method was used to identify the MDR1 gene. Remission status was determined after the induction phase of Indonesian Protocol ALL 2006. The sequencing results from 17 patients indicated that four children had mutations 3435T and 2677T, two possessed mutation 3435T and wild-type 2677G, and the remaining had wild-type 3435C and 26TTG. Of those 17 children, 16 were able to continue with the same chemotherapy protocol and had complete remission.
1 INTRODUCTION
Acute lymphoblastic leukemia (ALL) is the most frequently detected cancer in children worldwide (Zhai 2012) as well as the highest reported type in Department of Pediatric Hematology-Oncology, Sanglah Hospital, Bali (Mudita 2007). Multid-rug resistance-1 (MDR1) gene-encoded P-glyco-protein (P-gp) plays a role in drug resistance. It is able to pump out the drugs (e.g., vinca alkaloids, steroids, and anthracyclines) from the intracellular cytoplasm (Calado 2002, Wuchter 2000). P-gp overexpression exists in neoplastic cells, so it can deteriorate the therapeutic results and worsen prognosis (Li 2006, Leith 1999). The expression on leukemic cells is associated with chemotherapy resistance (Calado 2002, Wuchter 2000). The variation of P-gp expression is determined by the gene (Calado 2002). The differences in the frequencies of MDR1 gene polymorphisms are influenced by ethnic groups (Gregers 2015, Jamroziak 2005, Li 2006), which could be considered as a possible reason for different findings (Li 2006, Schwab 2003). Single-nucleotide polymorphisms (SNPs) at position 3435C > T (exon 26) and position 2677 G > T (exon 21) occur frequently (Fung 2009, Brambila-tapia 2013).
In this study, we aimed to identify variants 3435 and 2677 of the MDR1 gene in children with ALL in Sanglah Hospital, Bali, and to determine the chemotherapy results.
2 METHODS
This study was approved by Medical School, Udayana University, Sanglah Hospital ethical committee and conducted in Sanglah Hospital and Biology Molecular Laboratory, Faculty of Medical School, Udayana University. All children (0 to 12 years old) with ALL in Sanglah Hospital in the period of May 2015 to January 2016 who signed informed consent form were included in this study.
Buffy coat samples obtained from the patients’ whole blood or bone marrow aspiration were stored in –80°C. Deoxyribonucleic acid (DNA) was isolated from buffy coat with a standard salting out protocol. The primers to determine variant 3435 were 5’ACT CTTGTTTTCAGCTGCTTG 3’ (forward (F)) and 5’CATTAGGCAGTGACTCGATG 3’ (reverse (R)), producing 206 base pairs (bp) polymerase chain reaction (PCR) product (Miladpour 2009), and the primers for 2677 were 5’TATCCTTCATCTATGGTTGG 3’ (F) and 5’TTTAGTTTGACTCACCTTCCC 3’(R) (Huang 2005), yielding 155 bp product. PCR amplification was initiated with 5 min pre-denaturation at 94°C, which was followed by 35 cycles of denaturation (94°C, 90), annealing at 56°C (for 3435 SNP) and 48°C (for 2677, 60 s), and extension (72°C, 60 s). The final extension was at 72°C for 10 min. The PCR products were identified by electrophoresis in a 1.5% agarose gel that was stained with 0.5 μg/ml of ethidium bromide, and then visualized under a UV transilluminator. The remaining PCR products of each variant in exon 26 and 21 were sequenced and compared with the sequence of the wild-type (WT) MDR1 gene (Chen 1990).
All the patients received chemotherapy Indonesian Protocol ALL 2006 standard risk (SR) or high risk (HR). The chemotherapeutic response was based on remission status after induction phase. Data of complete remission (CR) achievement were collected from medical records. P-gp expression data were documented from our previous study with flow cytometry (Niruri 2017).
3 RESULTS AND DISCUSSION
On the basis of sequencing result from 17 patients (Table 1, Figures 1 and 2), 4 had mutations 3435T and 2677T, 2 possessed mutation 3435T and wild-type 2677G, and the remaining children had wild-type 3435C and 2677G. In this study, there was no patient with 2677G > A. The frequency of 2677G > T was much higher than 2677G > A (Fung 2009). Because of cell viability and availability of reagents in our previous study (Niruri 2017), not all the patients exhibited P-gp expression (Table 1).
The 3435 C > T (Figure 1) is a synonymous SNP, but it can alter mRNA level, protein folding to substrate specificity, and protein expression. Several studies have been conducted to identify the effect of the presence of variant 3435 and its haplotype on MDR1 structure and function. Some possibilities have been reported. First, stability of MDR1 mRNA was altered by the mutation (Fung 2009, Hoffmeyer 2000, Kimchi-Sarfaty 2007). Second, kinetics in translation can be altered by the use of a rarer codon (Fung 2009, Kimchi-Sarfaty 2007). It can alter the dynamics of protein folding. Synonymous polymorphism could result in ribosome stalling (Fung 2009, Tsai 2008). Nucleotide mutation can change the mRNA structures, which eliminate or generate new secondary structures (e.g., pseudoknot or hairpin). These changes can delay the ribosome and alter translation (Fung 2009). The 3435 C > T may interfere in co-translational folding in close amino acids (which are 30–72 codons in front of the mutant codon). The site of 3435 C > T is in the second ATP-Binding domain. The alteration on pause signal may affect the folding of Q-loop and walker-A motifs. Therefore, it can change MDR1 function such as by altering ATP-binding affinity or ability of ATP hydrolysis (Fung 2009). Meanwhile, another variant, the 2677 G > T (Figure 2), is a non-synonymous SNP. A change in the nucleotide sequence at position 2677 can cause a ribosome pause, which may alter the co-translation of amino acids, which are before the transmembrane domains (TM) 6 and TM 10 (Fung 2009, Sakurai 2007). Each allele that makes haplotype can produce a small but significant, synergistic, or additive change contribution to alter protein folding, function, and expression (Fung, 2009, Kim, 2006). Therefore, it can affect the disposition of chemotherapy drugs (Kim 2006).
Table 1. Remission status of the patients with MDR1 gene variants 3435 and 2677 (Ntotal = 17).
n (Nucleotide sequence of the MDR1 gene at positions 3435/2677)
SR/HR
3435 (Mut)/2677(Mut)
3435(Mut)/2677 (Mut)
3435(WT)/2677 (WT)
CR
SR
2** (gagatTgtg / ggtTctggg)
1* (gagatTgtg / ggtGctggg)
6 (gagatCgtg / ggtGctggg)
CR
HR
1** (gagatTgtg / ggtTctggg)
1* (gagatTgtg / ggtGctggg)
5 gagatCgtg / ggtGctggg)
CR
SR → HR
1** (gagatTgtg / ggtTctggg)
–
–
CR*
Total
4
2
11
17
Mut: mutant; WT: wild-type; CR: complete remission; SR/HR: standard risk or high risk; SR → HR: a switch protocol (from SR to HR) after the window phase of the induction course; (*): CR was achieved after the protocol was changed; (**): all the mutants have P-gp overexpression based on our previous study on P-gp expression in patients with ALL.
Image
Figure 1. Patients’ MDR1 sequence at position 3435: (A) wild-type sequence and (B) variant 3435C > T.
Image
Figure 2. Patients’ MDR1 sequence at position 2677: (A) wild-type sequence and (B) variant 2677G > T.
There were discrepancies among the studies of the MDR1 gene and chemotherapeutic responses. In acute myeloid leukemia (AML), the wild-type variants, a CC genotype at position 3435 and a GG genotype at position 2677, had higher probability to achieve CR and maintain 3-year event-free survival (EFS) than non-CC genotype at 3435 and non-GG genotype at 2677. The CC and GG genotypes were significantly related to a reduced expression of P-gp. Therefore, it could increase intracellular accumulation of the drugs. The influence of variants 3435 and 2677 on CR achievement might depend on the chemotherapeutic agents used in the induction course (Kim 2006). Haplotypes contribute to medication therapy outcome and disease susceptibility (Fung 2009). In this study, 16 out of 17 patients showed CR after induction phase, and the remaining 1 patient who had variants 3435 C > T and 2677 G > T must switch from standard-risk protocol to high-risk protocol to get CR (Table 1). A similar result was also found in a study conducted by Jamroziak (2005). Adult patients who were diagnosed with ALL with different MDR1 genotypes at 3435 showed a similar probability of achieving CR after the first induction phase (Jamroziak 2005). However, 3435 C > T was significantly related to risk of relapse (Jamroziak 2005, Gregers 2015). Adverse events on bone marrow during prednisolone, vincristine, and doxo rubicin in the induction course were more prominent in childhood ALL with 3435 TT than other genotypes (Gregers 2015). The effects of haplotype on therapeutic outcome, toxicity, and survival rate need to be explored in future studies.
One patient with 3435C > T and 2677G > T SNPs showed prednisone poor responders on window phase at induction of SR protocol (Table 1). In the ALL trial, patients with poor response after prednisone therapy had lower estimated EFS than those with good response (Bhojwani 2009). The patients’ protocol was switched to Indonesian Protocol ALL 2006 of HR group to get CR (Table 1). T-cell phenotype associated with a poor prednisone response was reported (Bhojwani 2009). Some possible mechanisms of reversal resistance by steroid switch occur, which would give a better response in cancer (Lorente 2014). On some trials, dexamethasone showed greater activity than prednisone in killing lymphoblast and in reducing the occurrence of central nervous system involvement because of higher level of free-drug and higher ability to pass through the blood–brain barrier (Balis 1987, Ito 1996, Mitchell 2005). However, adverse events occurred more frequently with dexamethasone than with prednisone (Belgaumi 2003, Hurwitz 2000, Mitchel 2005). Polymorphisms on glucocorticoid pathway genes e.g., MDR1 gene and NR3C1) were also significantly associated with hormone concentration and pharmacokinetic parameters (Nebesio 2016). All four patients in this study with mutants at position 3435 and/or 2677 showed P-gp overexpression, but different therapeutic responses (Table 1). More than 50 SNPs of the MDR1 gene have been reported on the National Center for Biotechnology Information (Fung 2009). The MDR1 gene variant 1236C > T was related to the treatment response of steroid in the idiopathic nephrotic syndrome (NS) (Safan 2016). A higher frequency of 1236C > T was found in late responders to pre...

Table of contents

  1. Cover
  2. Half Title
  3. Title Page
  4. Copyright Page
  5. Table of Contents
  6. Preface
  7. Organizing committee
  8. Keynote speakers
  9. Plenary speakers
  10. List of symposium speakers
  11. Medication management system in several care homes in Surabaya
  12. Effectiveness of decision aid on knowledge, decision conflict, and outcome in diabetic patients
  13. Self-esteem scale: Translation and validation in Malaysian adults living with asthma
  14. Factors affecting mortality among patients undergoing hemodialysis in Sudan
  15. Evaluating the effectiveness of filgrastim in patients with solid cancer
  16. Building care of hypertensive patients in reducing sodium intake in Banjarmasin
  17. Effect of glibenclamide on glycemic control in the presence of sodium diclofenac
  18. A drug utilization study of antibiotics in patients with osteomyelitis
  19. Factors influencing trastuzumab cardiotoxicity in breast cancer: A case–control study
  20. Transdermal patch loading diclofenac sodium for anti-inflammation therapy using a rat paw oedema model
  21. Ethambutol-induced optic neuropathy in diabetic patients with tuberculosis
  22. Identification of clinical specimens isolated from neonates
  23. Effect of coenzyme Q10 on the malondialdehyde level and exercise performance of male runners in Jakarta
  24. Compatibility of selected inotropic drugs in a syringe
  25. Ward pharmacist workload analysis in an Indonesian class A hospital
  26. Effect of LD50 of ethanolic leaf extract from Ipomoea reptans Poir. in rats
  27. Oral indomethacin versus oral paracetamol for patent ductus arteriosus closure in neonates
  28. Clinical trial of Jamu X on blood glucosa and HbA1C in patients with type 2 diabetes mellitus
  29. Management of carbamate or organophosphate intoxication at a high care unit
  30. Development of an antidepressant e-learning tool for pharmacology education
  31. Effectiveness of nimodipine on non-traumatic subarachnoid hemorrhage based on computed tomography angiography
  32. Study of pediatric compounded drug prescriptions in a health care facility in Bandung
  33. Efficacy of honey vinegar in hyperlipidemic rats (Rattus norvegicus)
  34. Improving the competence of pharmacist students through international lecturers
  35. The effectiveness evaluation of antiretroviral therapy in Mangusada Hospital Bali
  36. Drug therapy problems in pediatric and geriatric patients at Farmasi Airlangga Pharmacy
  37. PCR primer design for detection of SNPs in SLC22A1 rs683369 encoding OCT1 as the main transporter of metformin
  38. Pharmacist–patient communication: An observational study of characteristic information
  39. Multidrug resistance-1 gene variants in pediatric leukemia in Bali
  40. Medication adherence in the elderly with chronic diseases using the Adherence to Refill and Medication Scale (ARMS)
  41. Direct non-medical costs of patients with cervical cancer who underwent chemotherapy
  42. Factors influencing correct measurements of liquid medicines by consumers
  43. The correlation of service quality and complaint handling with patient satisfaction
  44. Assessment of medication safety among Filipino pharmacists
  45. Effect of the combination of Typhonium flagelliforme Lodd. (Blume) and Phyllanthus niruri Linn. on the immune system
  46. Organophosphate toxicity in red chili farmers, Ciamis, Indonesia
  47. Factors affecting the rational use of NSAIDs in self-medication
  48. The influence of adverse reactions of antituberculosis drugs to non-adherence in drug use
  49. (-)-Epigallocatechin gallate from green tea increases the level of a DNA repair enzyme
  50. Perceptions and practices of self-medication among healthcare students
  51. Smoking cessation counseling: Perceptions and barriers among community pharmacists
  52. Factors affecting medication noncompliance in patients with chronic diseases
  53. The development and evaluation of a clinical pharmacy course at a pharmacy school in Indonesia
  54. Relationship ejection fraction and segment ST-resolution in STEMI patients with streptokinase therapy
  55. Management of hyponatremia in patients with heart failure: A retrospective study
  56. Continuous infusion versus intermittent bolus furosemide in heart failure NYHA III-IV
  57. The effectiveness of empirical and definitive antimicrobial therapy
  58. In vivo analgesic effect of ethanolic extracts of exocarp, mesocarp, and seeds of Carica pubescens
  59. Evaluation of knowledge, attitude and perceived barriers towards adverse drug reaction reporting
  60. Hydroxyethyl starch or gelatin, which is safer for the kidneys?
  61. In silico QSAR of 1-benzoyl-3-benzylurea lead and its analogue compounds as anticancer
  62. A study on antiemetics for postoperative nausea and vomiting at Dr. Soetomo Hospital
  63. Ethanol extract of Annona squamosa L. improves the lipid profile in hyperlipidemia rats
  64. The effect of Telmisartan on lipid levels and proinflammatory cytokines in ESRD patients undergoing hemodialysis
  65. Risk assessment of ADEs: Patient safety incident reports at Ari Canti Hospital in 2016
  66. Medication-induced Adverse Drug Reaction (ADR) in the Malaysian elderly population
  67. Cost-effectiveness analysis of patients with schizophrenia in Madani Hospital
  68. Tacrolimus-induced symptomatic hyponatremia after kidney transplantation: A case study
  69. Postoperative pain management in elderly patients: Evaluating the use of analgesics
  70. Antimalarial activity and toxicological test of Andrographis paniculata tablets (AS202-01)
  71. Socioeconomic status and obesity in an adult rural population in Indonesia
  72. A strategic approach to increase the compliance of patients with type 2 diabetes mellitus
  73. Disposal practices of unused medication among the public in Meradong, Sarawak, Malaysia
  74. Drug use and potential drug interaction in the elderly
  75. Effects of audiovisual education on the knowledge and adherence of patients with DMT1
  76. Root extract of Imperata cylindrica L. improves serum nitric oxide levels in diabetic mice
  77. Medication use during pregnancy in Surabaya: A cross-sectional study
  78. Eyedrops use perception during fasting
  79. Author index

Frequently asked questions

Yes, you can cancel anytime from the Subscription tab in your account settings on the Perlego website. Your subscription will stay active until the end of your current billing period. Learn how to cancel your subscription
No, books cannot be downloaded as external files, such as PDFs, for use outside of Perlego. However, you can download books within the Perlego app for offline reading on mobile or tablet. Learn how to download books offline
Perlego offers two plans: Essential and Complete
  • Essential is ideal for learners and professionals who enjoy exploring a wide range of subjects. Access the Essential Library with 800,000+ trusted titles and best-sellers across business, personal growth, and the humanities. Includes unlimited reading time and Standard Read Aloud voice.
  • Complete: Perfect for advanced learners and researchers needing full, unrestricted access. Unlock 1.5M+ books across hundreds of subjects, including academic and specialized titles. The Complete Plan also includes advanced features like Premium Read Aloud and Research Assistant.
Both plans are available with monthly, semester, or annual billing cycles.
We are an online textbook subscription service, where you can get access to an entire online library for less than the price of a single book per month. With over 1.5 million books across 990+ topics, we’ve got you covered! Learn about our mission
Look out for the read-aloud symbol on your next book to see if you can listen to it. The read-aloud tool reads text aloud for you, highlighting the text as it is being read. You can pause it, speed it up and slow it down. Learn more about Read Aloud
Yes! You can use the Perlego app on both iOS and Android devices to read anytime, anywhere — even offline. Perfect for commutes or when you’re on the go.
Please note we cannot support devices running on iOS 13 and Android 7 or earlier. Learn more about using the app
Yes, you can access Unity in Diversity and the Standardisation of Clinical Pharmacy Services by Elida Zairina, Junaidi Khotib, Chrismawan Ardianto, Syed Azhar Syed Sulaiman, Charles Sands III, Timothy Welty, Elida Zairina,Junaidi Khotib,Chrismawan Ardianto,Syed Azhar Syed Sulaiman,Charles Sands III,Timothy Welty, Elida Zairina, Junaidi Khotib, Chrismawan Ardianto, Syed Azhar Syed Sulaiman, Charles D. Sands III, Timothy E. Welty in PDF and/or ePUB format, as well as other popular books in Medicine & Medical Theory, Practice & Reference. We have over 1.5 million books available in our catalogue for you to explore.