Infinity in the Palm of Your Hand
eBook - ePub

Infinity in the Palm of Your Hand

Fifty Wonders That Reveal an Extraordinary Universe

  1. 161 pages
  2. English
  3. ePUB (mobile friendly)
  4. Available on iOS & Android
eBook - ePub

Infinity in the Palm of Your Hand

Fifty Wonders That Reveal an Extraordinary Universe

About this book

A mind-bending journey through some of the most weird and wonderful facts about our universe, vividly illuminating the hidden truths that govern our everyday lives.
Fact: You could fit the whole human race in the volume of a sugar cube.
Fact: The electrical energy in a single mosquito is enough to cause a global mass extinction.
Fact: You age more quickly on the top floor than on the ground floor.
So much of our world seems to make perfect sense, and scientific breakthroughs have helped us understand ourselves, our planet, and our place in the universe in fascinating detail. But our adventures in space, our deepening understanding of the quantum world, and our leaps in technology have also revealed a universe far stranger than we ever imagined.
With brilliant clarity and wit, bestselling author Marcus Chown examines the profound science behind fifty remarkable scientific facts that help explain the vast complexities of our existence.

"The tone is consistently light and breezy...An addictive, intriguing, and entertaining read...A handy guide for anyone yearning to spice up their conversational skills."— Booklist

"Heavy stuff lightly spun?just the thing for the science buff in the house."? Kirkus Review

Trusted by 375,005 students

Access to over 1.5 million titles for a fair monthly price.

Study more efficiently using our study tools.

Information

Year
2019
eBook ISBN
9781635765939
image
1.

THE COMMON THREAD

You are a third mushroom
image
“How extremely stupid not to have thought of that.”
—THOMAS HUXLEY,
ON HEARING OF DARWIN’S THEORY OF
EVOLUTION BY NATURAL SELECTION
YOU ARE ONE THIRD mushroom. That’s right. You, me, all of us share a third of our DNA with fungi (as if my Christmas-card list was not long enough already!). This is strong evidence that humans and mushrooms—in fact all creatures that share the earth today—have a common ancestor. The person who first recognized this was the English naturalist Charles Darwin.
In 1831, aged just twenty-two, Darwin took up the post of ship’s naturalist on HMS Beagle. During its five-year voyage, he made a series of striking zoological observations. He noticed, for instance, that the birds and animals on the isolated Galápagos Islands, 1,000 kilometers off the west coast of South America, appeared to be variants of a small subset of birds and animals found on the continent. Not only that, but the birds and animals on each island of the Galápagos archipelago also differed from each other in subtle ways. Most famously, the finches that lived on islands where large nuts were available had stubbier beaks than finches on other islands.
After eighteen months of intense concentration, a light went on in Darwin’s mind. He realized why creatures were so exquisitely tailored for their environments. And it was not, as was the prevailing view, that they had been “designed” by a Creator. There was a perfectly natural mechanism that created the “illusion of design.”
Most creatures, Darwin recognized, produced many more offspring than could be supported by the available food and were therefore destined to starve to death. However, in the struggle for survival, those individuals best suited to exploit the resources of their environment persisted, whereas those least suited perished. The casualties were staggeringly huge. But, by this process of evolution by natural selection, creatures changed incrementally, generation by generation, to be better adapted to their environments.
Darwin reasoned that, millions of years before, when the volcanic Galápagos Islands had risen from the sea, a handful of creatures—birds that had flown and other animals that had been driven by storms across the ocean on mats of vegetation—had reached the archipelago from the mainland of South America. Finding an essentially empty world, they had spread out to fill all the available ecological niches. Darwin’s finches, isolated on different islands, had suffered the pressure of natural selection; the least adapted for survival had been brutally culled while the best adapted had prevailed. In the case of an island with large nuts, inevitably the finches that survived were variants with tough stubby beaks, perfect for cracking open big nuts.
Darwin’s courage was to present his theory of evolution by natural selection without knowing two key things: first, how characteristics were passed on, or inherited, from generation to generation; and, second, what created the variation in offspring—the raw material for natural selection to work on. We now know that these two things are intimately connected. The blueprint for an organism is recorded in the large biological molecule called deoxyribonucleic acid, or DNA, which is carried in every cell.1,2 And it is mutations in DNA, often caused during the copying process, when cells reproduce, that give rise to varied and novel traits in offspring. “The capacity to blunder slightly is the real marvel of DNA,” said the American biologist Lewis Thomas. “Without this special attribute, we would still be anaerobic bacteria and there would be no music.”
According to Darwin, all creatures on Earth today have evolved by a process of natural selection from a simple common ancestral organism. This, ultimately, is the reason why we share one third of our DNA with mushrooms. In fact, the following stretch of DNA is present in every cell of every creature on Earth, including every one of the one hundred trillion cells in your body: GTGCCAGCAGCCGCGGTAATTCCAGCT CCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG.3 Can there be a more striking piece of evidence that all creatures are related and that they evolved from a common ancestor, exactly as Darwin claimed? In the words of Thomas: “All of today’s DNA, strung through all the cells of the earth, is simply an extension and elaboration of the first molecule.”4
Darwin knew that the process of evolution by natural selection was painfully slow and would have required hundreds of millions, if not billions of years to create the profusion of life on Earth today. The first tentative evidence of life on our planet dates to about 3.8 billion years ago. Conceivably, the first cell—dubbed the “last universal common ancestor,” or LUCA—arose around four billion years ago, a mere half a billion years after the birth of the earth. Exactly how this happened—and how the step from nonlife to life was taken—remains one of the biggest unanswered questions in science.
2.

CATCH ME IF YOU CAN

Some slime molds have thirteen sexes
image
“I admit, I have a tremendous sex drive.
My boyfriend lives forty miles away.”
—PHYLLIS DILLER
SOME SLIME MOLDS HAVE thirteen sexes. (And you think you have trouble finding and keeping a partner!) Their sex cells, unlike human sperms and ova, which are hugely different in size, come in only one size. The gender of the cells is instead determined by three genes known as MatA, MatB, and MatC, which come in a number of variants. In fact, there are so many variants that potentially it is possible to have more than five hundred different sexes. To reproduce, a slime-mold spore must simply find a partner with different variants of its three genes.1
Nobody knows why some slime molds have thirteen sexes and some five hundred-plus. But then nobody knows why we have two sexes. Nor, for that matter, why we have sex.
In evolutionary terms the name of the game is to get your genes into the next generation.2 Not some of your genes but all of them. The sensible thing would therefore be to clone yourself since this ensures the transference of 100 percent of your genes to any offspring. Such asexual reproduction is in fact what most creatures on Earth practice. Organisms that have sex, on the other hand, pass on only 50 percent of their genes to the next generation. This means not only that they must give birth to twice as many offspring to achieve the same as asexual organisms but they must expend extra energy finding a partner as well. Sex appears to make no sense at all.
Many explanations for sex have been proposed but, until recently, none has been convincing. One, however, has now gained increasing acceptance—and, surprisingly it concerns parasites.
Across the world at any one time, more than two billion people are unfortunately infected with parasites, which range from intestinal worms to malarial parasites. Such parasites tend to be small and able to reproduce quickly, which means they can go through many generations during the lifetime of their host. As a consequence, they can quickly adapt to their host so that they efficiently exploit its resources. The exploitation of those resources, however, is at the expense of their host, which is not only weakened but sometimes even killed.
Understanding what sex has got to do with parasites takes a bit of background. Imagine the DNA of an organism to be like a deck of cards. When the organism clones itself, its offspring inherit the entire deck of cards with maybe one or two cards slightly changed due to a random mutation. By contrast, in sexual reproduction, offspring inherit half a deck of cards from one parent shuffled together with half a deck of cards from the other parent. This makes the offspring not only different from either parent but also utterly unique. Consequently, the parents’ parasites find themselves ill-adapted to the offspring and die.
The idea that sex continually wrong-foots parasites was proposed by the American biologist Leigh Van Valen in 1973.3 Basically the idea is that, although parasites can change rapidly, a host population can survive their relentless onslaught by changing even more rapidly.
In Through the Looking Glass, Lewis Carroll’s 1871 sequel to Alice in Wonderland, Alice runs beside the Red Queen but cannot understand why she is making no progress.
“In our country,” said Alice, still panting a little, “you’d generally get to somewhere else—if you run very fast for a long time, as we’ve been doing.”
“A slow sort of country!” said the Queen. “Now, here, you see, it takes all the running you can do, to keep in the same place.”
Van Valen’s parasite explanation for sex, which has become known as the “Red Queen Hypothesis,” received strong observational support in 2011.4 By genetic manipulation, biologists in the United States engineered two different populations of the roundworm Caenorhabditis elegans to reproduce in two different ways: one asexually, by fertilizing its own eggs; the other sexually, by female and male worms mating.5 The biologists then infected both groups of worms with a pathogenic bacteria. Serratia marcescens rapidly drove extinct the self-fertilizing population of worms but not the sexually reproducing ones. These outpaced their coevolving parasites—they continually ran faster. So, although it may not be the most romantic explanation for falling in love, defense against parasites seems to be the reason for sex.
3.

THE OXYGEN TRICK

Babies are powered by rocket fuel
image
“In every one of us there is a living process of combustion going on very similar to that of a candle.”
—MICHAEL FARADAY1
A BABY SQUIRMS IN A cot. A rocket climbs high in the sky on a column of smoke and flame. Not much connection between them, you might think. But you would be wrong. Both are energized by the same chemical reaction. Both are powered by rocket fuel.
This is actually not as surprising as it may appear. Boosting a heavy rocket into orbit requires the most powerful fuel—the one that, pound for pound, packs the biggest oomph. Life on Earth has been engaged in almost four billion years of trial-and-error experimentation. It would be odd if, in the attempt to power biological processes, it had not stumbled on the most potent energy source possible.
That energy source is the chemical reaction between hydrogen and oxygen—or combustion, as it is more commonly known. In the case of all animals, the hydrogen is extracted from food and the oxygen from the air. In the case of a rocket, liquid hydrogen and liquid oxygen are supplied by humans. Understanding how the reaction between hydrogen and oxygen works and where the tremendous energy comes from requires a little background.
Atoms of hydrogen and oxygen—in fact, all atoms—consist of a tiny nucleus and even tinier electrons. The electrons orbit the nucleus, snared by its powerful electric force, ...

Table of contents

  1. Cover Page
  2. Infinity in the Palm of Your Hand
  3. Title Page
  4. Copyright
  5. Dedication
  6. Contents
  7. Foreword
  8. PART ONE: BIOLOGICAL THINGS
  9. PART TWO: HUMAN THINGS
  10. PART THREE: TERRESTIAL THINGS
  11. PART FOUR: SOLAR SYSTEM THINGS
  12. PART FIVE: FUNDAMENTAL THINGS
  13. PART SIX: EXTRATERRESTIAL THINGS
  14. PART SEVEN: COSMIC THINGS
  15. Notes
  16. Acknowledgments
  17. About the Author

Frequently asked questions

Yes, you can cancel anytime from the Subscription tab in your account settings on the Perlego website. Your subscription will stay active until the end of your current billing period. Learn how to cancel your subscription
No, books cannot be downloaded as external files, such as PDFs, for use outside of Perlego. However, you can download books within the Perlego app for offline reading on mobile or tablet. Learn how to download books offline
Perlego offers two plans: Essential and Complete
  • Essential is ideal for learners and professionals who enjoy exploring a wide range of subjects. Access the Essential Library with 800,000+ trusted titles and best-sellers across business, personal growth, and the humanities. Includes unlimited reading time and Standard Read Aloud voice.
  • Complete: Perfect for advanced learners and researchers needing full, unrestricted access. Unlock 1.5M+ books across hundreds of subjects, including academic and specialized titles. The Complete Plan also includes advanced features like Premium Read Aloud and Research Assistant.
Both plans are available with monthly, semester, or annual billing cycles.
We are an online textbook subscription service, where you can get access to an entire online library for less than the price of a single book per month. With over 1.5 million books across 990+ topics, we’ve got you covered! Learn about our mission
Look out for the read-aloud symbol on your next book to see if you can listen to it. The read-aloud tool reads text aloud for you, highlighting the text as it is being read. You can pause it, speed it up and slow it down. Learn more about Read Aloud
Yes! You can use the Perlego app on both iOS and Android devices to read anytime, anywhere — even offline. Perfect for commutes or when you’re on the go.
Please note we cannot support devices running on iOS 13 and Android 7 or earlier. Learn more about using the app
Yes, you can access Infinity in the Palm of Your Hand by Marcus Chown in PDF and/or ePUB format, as well as other popular books in Scienze biologiche & Fisiologia. We have over 1.5 million books available in our catalogue for you to explore.