Biological Sciences
The Structure of RNA
RNA is a single-stranded molecule composed of nucleotides, each containing a ribose sugar, a phosphate group, and one of four nitrogenous bases: adenine, guanine, cytosine, or uracil. It has a similar structure to DNA but differs in that it typically exists as a single strand and contains the base uracil instead of thymine. RNA plays a crucial role in protein synthesis and gene regulation.
Written by Perlego with AI-assistance
Related key terms
1 of 5
10 Key excerpts on "The Structure of RNA"
- eBook - PDF
- Limsoon Wong(Author)
- 2004(Publication Date)
- World Scientific(Publisher)
Biologists describe RNA structures RNA Secondary Structure Prediction 169 in three levels: primary structure, secondary structure, and tertiary structure. The primary structure of an RNA is just its sequence of nucleotides. The secondary structure of an RNA specifies a list of canonical and wobble base-pairs that occur in the RNA structure. The tertiary structure is the actual 3D structure of the RNA. Although the tertiary structure is more useful, such a tertiary structure is diffi-cult to predict. Hence, many researchers try to get the secondary structure instead, as such a secondary structure can already explain most of the functionalities of the RNA. This chapter focuses on the secondary structure of RNAs. Consider a RNA polymer of length . Generally, the secondary structure of the RNA can be considered as a set of base pairs where that satisfies the following two criteria: (1) Each base is paired at most once. (2) Nested criteria: if , we have . Actually, a RNA secondary structure may contain base pairs that do not sat-isfy the two criteria above. However, such cases are rare. If criteria (1) is not satisfied, a base triple may happen. If criteria (2) is not satisfied, a pseudoknot be-comes feasible. Figure 1 shows two examples of pseudoknots. Formally speaking, a pseudoknot is composed of two interleaving base pairs and such that . g a a a c c c g a u u c a g g a a a c g c g u u a g c a u g g c c c c c a a g g a a g c Fig. 1. Pseudoknots. When no pseudoknot appears, the RNA structure can be described as a planar graph. See Figure 6 for an example. Then, the regions enclosed by the RNA back-bone and the base pairs are defined as loops. Based on the positions of the base pairs, loops can be classified into the following five types: Hairpin loop—a hairpin loop is a loop that contains exactly one base-pair. This can happen when the RNA strand folds into itself with a base-pair holding them together as shown in Figure 2. - eBook - PDF
- Lizabeth A. Allison(Author)
- 2021(Publication Date)
- Wiley-Blackwell(Publisher)
47 C H A P T E R T H R E E Fundamental Molecular Biology, Third Edition. Edited by Lizabeth A. Allison. © 2021 John Wiley & Sons Inc. Published 2021 by John Wiley & Sons Inc. Companion Website: www.wiley.com/go/allison/FMB3 The Versatility of RNA Tertiary structure of a catalytic RNA. (Source: From Cruz, J. A., & Westhof, E. (2009). Cell 136:604–609, © 2009 Elsevier). The most surprising aspect of all of this is how late in the study of cell biology the importance and ubiquitous nature of RNA in gene regulation became widely recognized. Philip A. Sharp, Cell (2009) 136:580. O U T L I N E ▶ 3.1 IIntroduction ▶ 3.2 RNA is involved in a wide range of cellular processes ▶ 3.3 Structural motifs of RNA ▶ 3.4 The discovery of RNA catalysis ▶ 3.5 RNA-based genomes 3.1 Introduction Chapter 2 began with a general description of the primary structures of both deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), but the remainder of the chapter focused exclusively on the properties of DNA. This chapter places RNA in the spotlight. Initial studies on RNA structure were pursued side by side with that of DNA, but for many years, RNA was seen as just as a go-between in the flow of information from gene to protein. As you may recall from Chap-ter 1, the central dogma states that specific DNA sequences are transcribed into messenger RNAs, which are then translated into proteins. This general way of thinking about the pathway of gene expression from DNA to functional prod-uct via an RNA intermediate overemphasizes proteins as the ultimate goal. What came as a surprise early on was the discovery of the tremendous variety and 48 Ch 3 The Versatility of RNA versatility of functional RNA molecules. RNA is involved in a wide range of cellular pro-cesses, including DNA replication, RNA processing, mRNA turnover, protein synthesis, and protein targeting. What makes RNA such a versatile molecule? The bottom line is that RNA has a much greater structural versatility compared with DNA. - eBook - PDF
Looking at Ribozymes
Biology of Catalytic RNA
- Fabrice Leclerc, Benoît Masquida(Authors)
- 2024(Publication Date)
- Wiley-ISTE(Publisher)
1 Fundamentals of RNA and Ribozyme Structure This chapter is intended to familiarize the reader with The Structure of RNAs. Understanding the structural basis of RNAs is a prerequisite for the study of ribozymes and RNA-mediated catalysis. This section shows how nucleotide stereochemistry guides the structuring of helices and consequently the addition of functional motifs that give this polymer its folding and interaction properties, as well as its catalytic properties. It is important to understand that all biological mechanisms rely on the interaction capabilities of structured molecules. The structure of biomolecules is therefore a fundamental aspect for the understanding of biology. The figures in this book are therefore often developed from experimental structures obtained by radio-crystallography or electron microscopy. Visualizing a biological mechanism through the molecular structures involved allows a better understanding of the actions of the different partners and the domains that compose them. It is then possible to deduce the mechanisms of chemical reactions and also to establish evolutionary relationships between homologous molecules of different organisms that perpetuate these mechanisms while adapting to different selection pressures resulting from distinct ecological constraints. For a color version of all the figures in this chapter, see www.iste.co.uk/masquida/ribozymes. zip. 2 Looking at Ribozymes 1.1. Sequences and secondary structures RNA (ribonucleic acid) is one of the three main biological polymers with DNA (deoxyribonucleic acid) and proteins. RNA adopts complex structures thanks to the physicochemical properties of the four main nucleotides from which it is assembled. The nucleotides are composed of a ribose-phosphate part and an aromatic part, the nucleobase, attached to the ribose. The base is composed of one or two fused aromatic rings containing imines and ethylenic carbons decorated by exocyclic amines and/or carbonyl groups. - eBook - PDF
- Bin Wang(Author)
- 2014(Publication Date)
- Jenny Stanford Publishing(Publisher)
Chapter 6 RNA Structure: Probing Biochemical Analyses Subash C.B. Gopinath Biomedical Research Institute & Nanoelectronics Research Institute, National Institute of Advanced Industrial Science and Technology, 1-1-1 Higashi, Tsukuba City 305-8562, Ibaraki, Japan [email protected] RNA–protein interactions are essential events of biological func-tions, which undergo the conformational changes of interacting molecules. To pinpoint the residues involved in these interactions, several approaches have been proposed by biochemical and biophysical approaches. These studies were able to map the binding regions on the interactive molecules, to shorten the size of the RNA molecule and to analyze the structural changes upon binding. Herein, biochemical structural probing analyses of RNAs upon interaction with protein were discussed based on nucleotide analog interference mapping, in-line probing and selective 2 -hydroxyl acylation analysis by primer extension chemistries. RNA Nanotechnology Edited by Bin Wang Copyright c 2014 Pan Stanford Publishing Pte. Ltd. ISBN 978-981-4411-64-6 (Hardcover), 978-981-4411-65-3 (eBook) www.panstanford.com 94 RNA Structure 6.1 Introduction Biological macromolecules including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) have intrinsic features and carry out various functions. DNA contains the genetic instructions to be used for the development and functions of all living things. RNA molecules are involved in most of the fundamental aspects and highly conserved cellular processes. Deemed as one of the most essential molecules in life, RNA participates in transferring genetic information to the translation machinery. Nucleic acids are made of nucleotides, which are a long chain of components consisting of nucleobases, sugars, and phosphate groups. With these components, both DNA and RNA fold to form a variety of helical structures in order to perform biological functions. - eBook - PDF
RNA Structure and Folding
Biophysical Techniques and Prediction Methods
- Dagmar Klostermeier, Christian Hammann, Dagmar Klostermeier, Christian Hammann(Authors)
- 2013(Publication Date)
- De Gruyter(Publisher)
Christina R. Mozes and Mirko Hennig 12 NMR-based characterization of RNA structure and dynamics 12.1 Introduction Genome-wide RNA-sequencing studies have revealed unexpected diversity and complexity of RNA species. It is estimated that less than 2% of the human genome encodes for proteins, yet the majority of DNA is transcribed into RNA. The biological motivation for this energetically expensive task is not fully understood, but we now know that noncoding RNAs have widespread roles including catalysis and gene regu- lation. Transcribed as single-stranded molecules, RNA can pair to itself, other RNA molecules, or DNA, and it can bind a host of biological macromolecules and cellular metabolites. The varied and specific three-dimensional (3-D) shapes that confer bio- logical function on RNA are surprising, given the restricted set of building blocks: four chemically similar nucleotides. Like the protein-folding problem, the RNA-folding problem considers the hierarchy of secondary and tertiary structures in deriving a compact fold from a primary sequence. While the base pairing that defines RNA secondary structure can be fairly accurately predicted from nearest-neighbor thermo- dynamic models (see Chapter 14), tertiary interactions are often weak enough that they can be disrupted by mild changes in solution conditions and temperatures and have mostly eluded predictive models. As a result of transient tertiary interactions, RNA molecules are dynamic, often displaying conformational heterogeneity that defies the designation of a single native-state structure. While multiple conformers and inherent dynamics can present serious challenges for structure determination, these are the very properties that allow RNA to sense external cues and transduce these cellular signals into functional responses. - eBook - ePub
- G Michael Blackburn, Michael J Gait, David Loakes, David M Williams, G Michael Blackburn, Michael J Gait, David Loakes, David M Williams, Jane A Grasby, Stephen Neidle(Authors)
- 2015(Publication Date)
- Royal Society of Chemistry(Publisher)
CHAPTER 7 RNA Structure and FunctionCONTENTS 7.1 RNA Structural Motifs 7.1.1 Basic Structural Features of RNA 7.1.2 Base Pairings in RNA 7.1.3 RNA Multiple Interactions 7.1.4 RNA Tertiary Structure 7.2 RNA Processing and Modification 7.2.1 Protecting and Targeting the Transcript: Capping and Polyadenylation 7.2.2 Splicing and Trimming the RNA 7.2.3 Editing the Sequence of RNA 7.2.4 Modified Nucleotides Increase the Diversity of RNA Functional Groups 7.2.5 RNA Removal and Decay 7.3 RNAs in the Protein Factory: Translation 7.3.1 Messenger RNA and the Genetic Code 7.3.2 Transfer RNA and Aminoacylation 7.3.3 Ribosomal RNAs and the Ribosome 7.4 RNAs Involved in Export and Transport 7.4.1 Transport of RNA 7.4.2 RNA that Transports Protein: the Signal Recognition Particle 7.5 RNAs and Epigenetic Phenomena 7.5.1 RNA Mobile Elements 7.5.2 SnoRNAs: Guides for Modification of Ribosomal RNA 7.5.3 Small RNAs Involved in Gene Silencing and Regulation 7.6 RNA Structure and Function in Viral Systems 7.6.1 RNA as an Engine Part: The Bacteriophage Packaging Motor 7.6.2 RNA as a Catalyst: Self-Cleaving Motifs from Viral RNA 7.6.3 RNA Tertiary Structure and Viral Function References7.1 RNA STRUCTURAL MOTIFS
RNA is the most versatile macromolecule in nature. The linear sequence of an RNA can encode large amounts of complex information that is subsequently transformed into functional proteins. However, many RNA sequences also contain sufficient information to fold themselves into specific shapes with distinct chemical properties. Thus, RNA is unique amongst biopolymers in that it encodes genetic information, provides structural scaffolding, recognizes and transports other molecules, and carries out many forms of chemical catalysis in the cell. - David Van Vranken, Gregory A. Weiss(Authors)
- 2018(Publication Date)
- Garland Science(Publisher)
(A) In the primary structure, the sequence includes unusual bases produced by modification reactions after tRNA synthesis. symbols other than A, C, G or U refer to enzymatically modified nucleosides. (B) the secondary structure resembles a clover leaf; highlights indicate loops and an unpaired region associated with mRNA and protein binding. (C) the tertiary structure reveals interactions between elements of secondary structure such as contacts between the D loop and t loop. (Adapted from B. Alberts et al., Molecular Biology of the Cell, 5th ed. New York: Garland science, 2008.) Use a free Web-based RNA structure prediction program (such as RNAfold) to determine the structure of the tRNA phe from Thermus thermophilus: 5ʹ-GCCGAGGUAGCUCAGUUGGUAGAGCAUGCGACUGAAAAUCGCAGUGUCGGCGGUUC GAUUCCGCUCCUCGGCACCA-3ʹ. Problem 4.4 138 ChAptER 4: RNA but searching an RNA database for this exact sequence would miss the other 255 sequences (such as 5ʹ-GAGGUUCGCCUC-3ʹ) that can also form a hairpin held together by four base pairs. To illustrate the strengths and limitations of RNA structure predic- tion, consider the challenges of uncovering short RNA sequences that form hairpin structures. Sequences with such structures are found in a class of RNAs called micro- RNAs and are described in further detail later in this chapter. Focusing searches on complementary bases required to form the microRNA structures improves the search results and can identify large numbers (at least 30,000) of stem loops (Figure 4.14). Much better approaches use structure prediction techniques and use biological infor- mation, such as the conservation of sequences across related species. Ultimately, predictions of RNA structure and homology require experimental ver - ification. X-ray crystallography provides the gold standard for determining the struc- ture of RNA sequences, although RNA structures compose only a minor percentage of all biopolymer structures deposited in the Protein Data Bank.- eBook - PDF
Structural Bioinformatics
An Algorithmic Approach
- Forbes J. Burkowski(Author)
- 2008(Publication Date)
- Chapman and Hall/CRC(Publisher)
125 C H A P T E R 5 RNA Secondary Structure Prediction The role of proteins as biochemical catalysts and the role of DNA in storage of genetic information have long been recognized. RNA has sometimes been considered as merely an intermediary between DNA and proteins. However, an increasing number of functions of RNA are now becoming apparent, and RNA is com-ing to be seen as an important and versatile molecule in its own right. PAUL G. HIGGS (Quarterly Reviews of Biophysics, 33, 2000, p. 199) The idea that a class of genes might have remained essentially unde-tected is provocative, if not heretical. It is perhaps worth begin-ning with some historical context of how ncRNAs have so far been discovered. Gene discovery has been biased towards mRNAs and proteins for a long time. SEAN R. EDDY (Nucleic Acids Research, 27, 2001, p. 919) 126 < Structural Bioinformatics: An Algorithmic Approach 5.1 MOTIVATION The functionality of RNA is determined by its 3-D structure. As described earlier, this structure mainly comprises helical stems and various loops that cooperate to undertake a variety of cellular functions: mRNA Messenger RNA (mRNA) carries genetic information from DNA to the ribosome, where it directs the biosynthesis of polypeptides. tRNA Transfer RNA (tRNA) facilitates the transfer of a particular amino acid to the growing polypeptide when its anticodon region recog-nizes a codon of the mRNA. rRNA Ribosomal RNA (rRNA) is found in ribosomes and can act as the catalytic agent in protein synthesis. ncRNA Noncoding RNA (ncRNA) molecules are active in biological pro-cesses such as regulation of transcription and translation, replication of eukaryotic chromosomes, RNA modification and editing, mRNA stability and degradation, and protein translocation (excellent intro-ductions to this exciting topic may be found in [Ed01] and [St02]). Strictly speaking, the ncRNA category includes tRNA and rRNA, but these are usually given their own separate categories. - David Van Vranken, Gregory A. Weiss, GREGORY A WEISS, Gregory A Weiss(Authors)
- 2018(Publication Date)
- Garland Science(Publisher)
4.13 Primary, secondary, and tertiary structure of tRNA. (A) In the primary structure, the sequence includes unusual bases produced by modification reactions after tRNA synthesis. Symbols other than A, C, G or U refer to enzymatically modified nucleosides. (B) The secondary structure resembles a clover leaf; highlights indicate loops and an unpaired region associated with mRNA and protein binding. (C) The tertiary structure reveals interactions between elements of secondary structure such as contacts between the D loop and T loop. (Adapted from B. Alberts et al., Molecular Biology of the Cell, 5th ed. New York: Garland Science, 2008.)Within larger RNA structures, Watson–Crick base pairs can be disrupted or distorted. Other secondary structure elements can push on the helices, breaking up their hydrogen bonding. In addition, internal loops consist of runs of Watson–Crick base pairing interrupted by loops lacking the base pairs. In such loops, non-Watson–Crick base pairing can also contribute essential hydrogen-bonding interactions. A large number of different RNA tertiary structures have been described, including the hook-turn, kink-turn, tetraloop receptor, and lone-pair triloop interactions. Almost all RNA structures bind specifically to Mg2+ at the physiological concentrations of 0.5–1 mM.Despite the complications imposed by disrupted base pairing and the large potential diversity of tertiary structures, RNA structures are relatively well understood at the level of base pairing. Furthermore, RNA folding patterns are even predictable from short RNA sequences by using free Web-based prediction programs. For more accurate structure prediction, computational folding predicts structures by modeling potential base pairs, loops, and other structures. The free energy expected for each model structure is calculated from the sum of the favorable (for example hydrogen bonds from base pairing) and the unfavorable (for example steric clash) interactions. The model with the lowest free energy is considered the best prediction of the RNA fold.- eBook - PDF
Bioinformatics
Genomics and Post-Genomics
- Frédéric Dardel, François Képès, Noah Hardy(Authors)
- 2007(Publication Date)
- Wiley(Publisher)
6 Structure prediction 6.1 The Structure of RNA As the material basis of genes and the vector of heredity, DNA has for many years occupied a preeminent place in the family of nucleic acids. In 1953, Watson and Crick predicted its double-helical structure, now recognized as practically universal, one of the essential advances in modern molecular biology. Compared with DNA, RNA seemed to be a poor relative, and was relegated to secondary roles. Three main families of RNA molecules could be identified: • Messenger RNA (mRNA) molecules, considered to be ephemeral copies of DNA used in protein translation; • Ribosomal RNA molecules, long reduced to the role of internal ribosome scaffolding, with no real function, since ribosomal functions were attrib-uted to their protein components; • Transfer RNA (tRNA) molecules, considered to be little more than molecular adapters for ferrying amino acids to the ribosome. The rehabilitation of RNA began in the early 1980s, when the introns of some mRNA molecules were found to be capable of excision in the absence of pro-teins. Other RNA molecules were later found to be endowed with catalytic prop-erties; for example, ribonuclease P, an enzyme responsible for the maturation of tRNA. This amounted to a conceptual revolution leading to the recognition of these RNA enzymes, which came to be known as ribozymes . There is now good reason to believe that RNA is responsible for polymerase activity in the ribosome, and that the proteins that adorn RNA molecules are not there just to stabilize and/or enhance that activity. This has recently been confirmed by resolution of the three-dimensional structure of the ribosome, revealing the active site of the ribonucleoproteic assembly to consist exclusively of RNA. Bioinformatics: Genomics and post-genomics , Frédéric Dardel and François Képès © 2006 John Wiley & Sons, Ltd
Index pages curate the most relevant extracts from our library of academic textbooks. They’ve been created using an in-house natural language model (NLM), each adding context and meaning to key research topics.









